Skip to main content

Table 1 Sequences of gene-specific primers used in this study

From: Characterization of differential expression and leader intron function of Arabidopsis atTOC159 homologous genes by transgenic plants

Gene Forward primers (5′ to 3′)a Reverse primers (5′ to 3′)a
159PUI GCCAAGCTT GGATTTGTGTTATGTTTCTCGC CGGGGATCC CCGCTTTGCTACTGAGACTC
132PUI GCCAAGCTT TAGCTGCACCAGCTTATTGAG CGGGGATCC TCTAGATCACCACCGCTACG
132P GCCAAGCTT TAGCTGCACCAGCTTATTGAG CGGGGATCC CAGAAGTTAGAGATAGAGAGAG
120PUI GCCAAGCTT AGTGTGGTGTTGTTTAAGTGTG CGGGGATCC CTAGGATCACCCAAAATCACG
120P GCCAAGCTT AGTGTGGTGTTGTTTAAGTGTG CGGGGATCC CTGGTTAGAGAAGGCAAAAGTC
90PUI GCCAAGCTT AGACGAAGATGTCGTCATTGG CGGGGATCC AACTATCTGCCCAACAGCAAG
90P GCCAAGCTT AGACGAAGATGTCGTCATTGG CGGGGATCC TTGTGTTGGCGAGAGAAAGAG
  1. aThe underlined sequences are additional restriction sites. Bam HI, GGATCC; Hind III, AAGCTT.