Skip to main content

Table 1 Primers used for quantitative RT-PCR analysis

From: Cytokinin, auxin, and abscisic acid affects sucrose metabolism conduce to de novo shoot organogenesis in rice (Oryza sativa L.) callus

Gene Accession number Forward (5′-3′) Reverse (5′-3′)
OsCIN1 AY578158 TACGGCAACTTCTACGCATC CTTGTCGTAGGTGACGCTGT
OsSUT1 D87819 TCCTCTGGTTCCACAAACAA ATTTGCACAAGCTTCACAGC
OsSUT2 AB091672 ATTCCCGTTCACCGTTACTC AGGATTGAGGCTCTTGCACT
OsPIN1 AF056027 AACCCGAACACCTACTCCAG CATCTCGAAGTTCCACCTGA
ORR1 AB246780 GCCATTTGCAGAAGTTCAGA AAGTCCTCCCAGTGAGCCTA
OsLEA1 AK064055 GACGACAAGATGCTCAAGGA CATGCACATGGATACACCAA
OsUBI D12629 CGCAAGTACAACCAGGACAA TGGTTGCTGTGACCACACTT