Skip to main content

Table 2 Primer sequences and restriction enzymes of STS and CAPS markers yielding polymorphic bands for tea germplasm

From: Development of STS and CAPS markers for variety identification and genetic diversity analysis of tea germplasm in Taiwan

Marker* Forward primer Reverse primer Size (bp) Annealing temp. Nuclease Size of major bands (bp) Allele number PIC§ Reference sequence Prediction function
C01 GAGGGGAAGGATGGATTGTT GTGCCACAAATGACCTACGA 677 55°C Taq I A: 677 B: 552 + 125 2 0.15 AY741470 photosystem II CP43 protein
C02 GAGGGGAAGGATGGATTGTT GTGCCACAAATGACCTACGA 677 55°C Bsr DI A: 677 B: 483 + 194 2 0.13 AY741470 photosystem II CP43 protein
C03 GAGAGAGAGGGATTCGAACC GTTTTTGGAGCTGGGATGAA 659 55°C Sfa NI A: 659 B: 449 + 210 2 0.27 AY839880 trnS ~ trnfM
M01 TGGTGAGGAGCATTGTTTTG GAGCAAACACTCGAACGTGA 836 55°C Eco RI A: 836 B: 509 + 327 2 0.15 AY839898 NADH dehydrogenase subunit 1
M02 CCAATTTTTGGGCCAATTCC TCTCTAAAGGGGCGTAAGCA 610 55°C Hinc II A: 610 B:385 + 225 2 0.31 AY845285 NADH dehydrogenase subunit 5
M03 GCCGGAAAAATAACAGACGA AAAAGGAAGGTTGGGTGCTT 458 55°C Bbs I A: 458 B: 308 + 149 2 0.28 AY845314 NADH dehydrogenase subunit 7
M04 GATAGGAGCATTCGGTGGAA CGGTAACCAAAGCGTATCGT 844 55°C Hph I A: 805 + 35 B: 492 + 313 + 35 2 0.28 AY845314 NADH dehydrogenase subunit 7
M05 ACAGCACCTTTTTCCCCTCT CATAACACGGCTCTCCCACT 686 55°C Xmn I A: 686 B:443 + 243 2 0.34 AY845314 NADH dehydrogenase subunit 7
M06 TGAATGAATCCCATCCCCTA GGCATACAACCGAAACGACT 413 55°C Rsa I A: 413 B:309 + 104 2 0.35 AY845285 NADH dehydrogenase subunit 5
M07 TAGCTATGCCCTGCTTGGTC CCTGTCTGTCGTACCGTTGA 667 55°C Bss SI A: 667 B: 460 + 207 2 0.28 AY845298 NADH dehydrogenase subunit 7
G01 TGCTTTGCGTCAATAACTGC TGATACATCCTCGCCAACAA 647 55°C Hph I A:647 B:441 + 206 2 0.25 DQ869863 zinc finger protein
G02 GCCTATCTAATCTACTCGGCTTTCT AGTAACACTAACCCACCCAACAATA 834 55°C Fsp I A:834 B:645 + 189 2 0.36 AB117640 ammonium transporter
G03 GCCTATCTAATCTACTCGGCTTTCT AGTAACACTAACCCACCCAACAATA 834 55°C Ava I A:834 B:729 + 105 C:501 + 228 + 105 3 0.55 AB117640 ammonium transporter
G04 GAGACAGAGGACTACTTCGATTCAG GAATCAGAAATGATACAGAGGAGGA 721 55°C Mse I A:721 B:447 + 274 2 0.37 AB247282 cyclin D3-1
G05 GAGACAGAGGACTACTTCGATTCAG GAATCAGAAATGATACAGAGGAGGA 721 55°C Rsa I A:721 B:571 + 150 2 0.30 AB247282 cyclin D3-1
G06 GCCTATCTAATCTACTCGGCTTTCT AGTAACACTAACCCACCCAACAATA 834 55°C Nde I A:834 B:749 + 85 2 0.25 AB117640 ammonium transporter
G07 GCCTATCTAATCTACTCGGCTTTCT AGTAACACTAACCCACCCAACAATA 834 55°C Hph I A:510 + 147 B:468 + 147 + 120 + 57 2 0.31 AB117640 ammonium transporter
G08 GCCTATCTAATCTACTCGGCTTTCT AGTAACACTAACCCACCCAACAATA 834 55°C Ava II A:443 + 190 + 134 + 67 B: 324 + 67 2 0.15 AB117640 ammonium transporter
G09 GCCTATCTAATCTACTCGGCTTTCT AGTAACACTAACCCACCCAACAATA 834 55°C Bst UI A:575 + 204 + 55 B:455 + 204 + 120 + 55 2 0.07 AB117640 ammonium transporter
G10 TGAGACAACATTATGGTCGATAGAA ATACTCCTTGCAAACTTCTGAATTG 750 55°C Bst YI A:750 B:590 + 160 2 0.14 AY641731 trans-cinnamate 4-hydroxylase
G11 TGAGACAACATTATGGTCGATAGAA ATACTCCTTGCAAACTTCTGAATTG 750 55°C Bst UI A:750 B:470 + 280 2 0.10 AY641731 trans-cinnamate 4-hydroxylase
G12 ACGACTACAGCTTCTTTCTCTACCA ATACACCTCGTCGACATACTTCTTC 824 55°C Ava I A:824 B: 527 + 297 C:325 + 202 3 0.43 AB114913 ammonium transporter
G13 CCATCAAATCCATTGGGAAC AAGACGAGCCAGGAGAAACA 580 60°C Mbo II A:580 B:449 + 131 2 0.10 EF205149 1-aminocyclopropane-1-carboxylate synthase
G14 CCATCAAATCCATTGGGAAC AAGACGAGCCAGGAGAAACA 580 60°C Bsr DI A:359 + 221 B:455 + 125 C:221 + 218 + 141 D:260 + 195 + 125 E:359 + 125 + 96 F:455 + 320 + 260 + 125 G:260 + 125 + 99 + 96 7 0.52 EF205149 1-aminocyclopropane-1-carboxylate synthase
G15 GCCTATCTAATCTACTCGGCTTTCT AGTAACACTAACCCACCCAACAATA 834 55°C Bsa JI A:546 + 288 B:318 + 288 + 228 C:546 + 183 + 105 D: 318 + 228 + 183 + 105 5 0.58 AB117640 ammonium transporter
G16 CCTACAAAACAGTCATAAGCCAACT ACGAAAACACTCTTGATCAGTAAGG 572 55°C Bbv I A:309 + 263 B:263 + 166 + 143 2 0.04 AB015047 PR-1 like protein
G17 ACGTGTGTGTTTCATTTGCC AACCCAATGATGTGTAAGTG 556/401 55°C Mbo II A:556 B:455 + 101 C:300 + 101 3 0.28 D26596b phenylalanine ammonia-lyase
G18 CTTACGGCTCTCGCAGAAGA GAACCGTGATCCAGGTTTTG 1100/930 55°C Hind III A:1100 B:930 C:650 + 280 3 0.49 AY641730 flavanone 3-hydroxylase
G19 TGCTTTGCGTCAATAACTGC TGATACATCCTCGCCAACAA 647 55°C Hpa II A:619 + 28 B:463 + 156 + 28 2 0.37 DQ869863 zinc finger protein
G20 ACGTGTGTGTTTCATTTGCC AACCCAATGATGTGTAAGTG 556/401 55°C Hph I A:556 + 401 B:401 C:319 + 237 D:237 4 0.47 D26596a phenylalanine ammonia-lyase
G21 ACGTGTGTGTTTCATTTGCC AACCCAATGATGTGTAAGTG 556/401 55°C Taq I A:556 B:460 + 96 C:305 + 96 3 0.53 D26596a phenylalanine ammonia-lyase
G22 CTTACGGCTCTCGCAGAAGA GAACCGTGATCCAGGTTTTG 1100/930 55°C Bst YI A:930 B:680 + 250 C:510 + 420 D:680 + 420 4 0.62 AY641730 flavanone 3-hydroxylase
G23 CTTACGGCTCTCGCAGAAGA GAACCGTGATCCAGGTTTTG 1100/930 55°C Bbs I A:1100 B:930 C:600 + 330 3 0.55 AY641730 flavanone 3-hydroxylase
G24 CCAGGAACACCAACAACCCGT CCATGCTGCTTTCTCTGCCAA 958 55°C Hind III A:958 B:550 + 408 2 0.35 AB018685b dihydroflavonol 4-reductase
G25 GATCCTTCAGACATGCAGAGC CACTTCCTCAAGTGATGCAAA 960 55°C Rsa I A:960 B:605 + 355 2 0.21 EF526217 caffeine synthase
G26 CGACCATCCTGCAATTTTCT AACGTCATTAGGACCTTCAATCG 299 55°C Taq I A:310 B:299 C:290 D:277 4 0.49 EF205148 leucoanthocyanidin reductase
G27 GGTGCTCAGGACATGGTTTT CGCTCTATTCCCTGCAAGTC 377 55°C Hph I A:377 B:198 + 179 2 0.37 DQ194358 flavonoid 3′,5′-hydroxylase
PAL ACGTGTGTGTTTCATTTGCC AACCCAATGATGTGTAAGTG 556/401 55°C - A:556 B:401 2 0.27 D26596a phenylalanine ammonia-lyase
F3H CTTACGGCTCTCGCAGAAGA GAACCGTGATCCAGGTTTTG 1100/930 55°C - A:1100 B:930 2 0.28 AY641730 flavanone 3-hydroxylase
  1. *Note: “C” represents chloroplast CAPS markers, “M” represents mitochondria CAPS markers, “G” represents nuclear CAPS markers, and “PAL”, “F3H” represents nuclear STS markers.
  2. §PIC Polymorphism Information Content.
  3. The primer pairs were referenced from (a) Kaundun and Matsumoto (2004) and (b) Kaundun and Matsumoto (2003).