Skip to main content

Table 1 Primers used for amplification of probes in Northern blot assay

From: Ectopic expression of Lc differentially regulated anthocyanin biosynthesis in the floral parts of tobacco (Nicotiana tobacum L.) plants

Gene Forward primer (5′–3′) Reverse primer (5′–3′)
Lc GGATC ATGGCGTTTCAGCTTC GGTAACCTCACCGCTTCCCTATAGCT
PAL TCCTTTCACTTCGCTCCAAC GGGAGAAAATTGAGGGGTTA
4CL ACACAATCCGATGAGCATGA CCCCAGACATGACAGTCCTT
CHS TGAAAAATCGATGATTAAGAAGAGG TCTGGAATTGGATCAGAACCTATAA
DFR ACAACAAGAAGGTCAAGCATCTATT CCAGTAATTAGTGAAAGTGCAGTGA
ANS GTTTTCCCCGAGGACAAGTG TTTCAAGGGTGTCCCCAATA
GST AGCCAATGTTGGGAATGGTA TTCCCGAAGGACATGTTAGG
AN2 CCTCATGATCAAAAGGAGAGC AGAAGTGGCATTTCCTCATGC