Skip to main content

Table 1 Primers of catechin biosynthetic genes for real-time PCR analysis in Camellia sinensis

From: Accumulation of catechins and expression of catechin synthetic genes in Camellia sinensis at different developmental stages

Gene Accession no. Primer sequence 5′−3′
CHS1 D26593 Forward: CAGAGCACGTACCCGGATTATTAC
Reverse: GGTACTTCAACCACAACCATGTCC
CHS2 D26594 Forward: CATTACTAACAGCGAGCATAAAACG
Reverse: TAGTTTTGGGACTTCAACAACCAC
CHS3 D26595 Forward: CCTCTTCCTAGCTAGCACATACCA
Reverse: TGCTCGCTATTAGTAATCCGAAAGT
ANS GAAC01051116 Forward: TGGGAAGACTATTTCTTCCACCTT
Reverse: TTCTAGTCGGCCTTCTTCTAGTCC
ANR1 GU944768 Forward: CCTTCTAGCACTAAAGGGTTCAGG
Reverse: TGACTACTCCTTGAATTGCTGGTT
ANR2 JN024667 Forward: TCACAGGGAATGAATTCCTCATAG
Reverse: GGAACATTGTACTGGGGGTATCTT
LAR EF205148 Forward: TTTTGTTGCAGGCTCTGATATAGG
Reverse: ATTATATTCACTGCTGCTGCTGCT
18S rRNA AB120309.1 Forward: TCTCAACCATAAACGATGCCGACCAG
Reverse: TTTCAGCCTTGCGACCATACTCCC