Skip to main content

Table 1 Primer sequence for starch synthesis related gene

From: Starch accumulation in hulless barley during grain filling

Gene NCBI accession Forward primers (5′–3′) Reverse primers (3′–5′) Annealing temperature (°C)
AGPP AK359692 TTCAGTTTCATGACCGTTC AGTATCCATCTGTCTCCCTC 60
GBSS I AY050174 GACACTATCGTGGAAGGCAAG TTGACCATCTCATGGTACGC 60
GBSS II AF109395 CACAGAATGCCAGAGGCATAG GAACAGATGGGAATCACTCCA 60
SSS I AJ292521 GCAAAAGGAGAGGAGGGTACA ACGTATGGTCTTTCGTCATGC 60
SSS II AB201445 GCTACACCAACTTCTCCCTG GATGATCTCCACGCCCTTCT 60
SSS III AF258608 GACATGTGGTTTTGCTTGGTT AGCCAGCGTATATCAGGTGAG 60
SBE I AF286317 ATGTTTGGTGGACATGGAAGA ATGTTTGGTGGACATGGAAGA 60
SBE IIa Y11282 ATGTTTGGTGGACATGGAAGA ATGTTTGGTGGACATGGAAGA 60
SBE IIb AY740401 ATGTTTGGTGGACATGGAAGA ATGTTTGGTGGACATGGAAGA 60
Actin DN551593 GGAAAAGTGCAGAGAGACACG TACAGTGTCTGGATCGGTGGT 60