Skip to main content

Table 1 List of primers used in the experiment

From: Characterization of LhSorTGA2, a novel TGA2-like protein that interacts with LhSorNPR1 in oriental hybrid lily Sorbonne

Experiment Primer name Primer sequence (5′–3′)
LhSorTGA2 5′ RACE LhSorTGA2-5RACE-1 CAGGTCAGCAGCATCCTCAATTCGG
  LhSorTGA2-5RACE-2 ATAGCCCCGAAGTCAGAAACCCGGG
LhSorTGA2 3′ RACE LhSorTGA2-3RACE-1 GAACCTCCAGCAGTCCTCCCAGCAG
  LhSorTGA2-3RACE-2 GGGTCAGATGGCTATGGCGATGGGA
BIFC LhSorTGA2-BIFC-F CGTCTAGAATGCACTCCTCCCGGGTTTCT
  LhSorTGA2-BIFC-R CGGGTACCTTCCCGTGGACGGGCTAGCCA
  LhSorNPR1-BIFC-F CGGGGCCCATGGCCGACGCCGCCGAGTG
  LhSorNPR1-BIFC-R CGGGATCCTCATTCTTCCATATCTACCAGACA
Y2H LhSorTGA2-GADT7-F CGGAATTCATGCACTCCTCCCGGGTTTCT
  LhSorTGA2-GADT7-R CGGGATCCCTCATTCCCGTGGACGGGCTAG
  LhSorNPR1-GBKT7-F CGCCATGGAGATGGCCGACGCCGCCGA
  LhSorNPR1-GBKT7-R CGGGATCCCTCATTCTTCCATATCTACCAGACAG
Subcellular localization LhSorNPR1-sub-F ATATCCATGGTAATGGCCGACGCCGCCGA
  LhSorNPR1-sub-R CGACTAGTTTCTTCCATATCTACCAGACAGACA
  LhSorTGA2-sub-F CGACTAGTATGCACTCCTCCCGGGTTTCTGA
  LhSorTGA2-sub-R CGACTAGTTTCCCGTGGACGGGCTAGCCA
LhSorTGA2 qPCR LhSor TGA2 qPCR-F TCAGATGGCTATGGCGATGG
  LhSor TGA2 qPCR-R CGGATTGGCGAGTAGTGAGT
  1. Restriction sites for vector construction are underlined