Skip to main content

Table 1 Sequences of PCR primers used in this study

From: Identification and cytochemical immunolocalization of acetyl-CoA acetyltransferase involved in the terpenoid mevalonate pathway in Euphorbia helioscopia laticifers

Target code Sequence (5′ → 3′) Purpose
P1-S AATGACTTTGGAATGGGAGTTTG Conserved fragment cloning
P1-A TAAATAGTTCAGGAGCCTGAGC Conserved fragment cloning
P2-S GGCTTAGGAAAGTTTGATGCTG 3′-RACE outer PCR
P3-S CTGTTACTGCTGGAAATGCCTCTA 3′-RACE inner PCR
P2-A CCGCATCACCATATCCACGTATTCTAG 5′-RACE outer PCR
P3-A GTGCAGATATTCCACGCTCAAAGC 5′-RACE inner PCR
P4-S ATTCCCCTTTCCTTCAATCTCAG Full-length cDNA cloning
P4-A TGTAACAGACAGAACAGGATGGC Full-length cDNA cloning
Actin-S GGTAACATTGTGCTCAGTGGTGG Reference gene
Actin-A AACGACCTTAATCTTCATGCTGC Reference gene
P5-S GCAGGACGAGGAAAATCATC Quantitative real-time PCR
P5-A CCAGCAGTAACAGAACCACC Quantitative real-time PCR