Skip to main content

Table 1 Primer sequences used in real-time PCR analysis

From: Effects of different growth temperatures on growth, development, and plastid pigments metabolism of tobacco (Nicotiana tabacum L.) plants

Gene and abbreviation Forward primer (5′–3′) Reverse primer
β-Actin CTGAGGTCCTTTTCCAACCA TACCCGGGAACATGGTAGAG
CL10247
Glutamyl-tRNA reductase (Glu-TR)
TGGTGTCCGTTTCGCTGT GCTGTGGTATCTTCTGGCTTTTC
CL941. Contig 3
Ferri chelatase (FeCH)
GGACGAGAAATGAATCCTACCG GCCCCGACAGAACAAAACA
Gi2318136
Magnesium chelatase (MgCH)
TGATGCCACATTCCAGAACC GGCTTCTTCCCGTCTTTCCT
CL1870. Contig 2
Protochlorophyllide oxidoreductase (POR)
CCACGAAGAAACTGGCATTACA CTGGAATGGAGGGAAAAGGAG
CL4058. Contig 1
Chlorophyllase (CHLase)
CTCTCTTCCCAGCTTGTGCTC CCTTGCCTCTAATCCCTTTTGTT
Unigene40510_Rwg20A
Mg-dechelatase (MDcase)
TCTATCCATCATCTGGCGTTTG GGCTTCTTCCCGTCTTTCCT
Unigene38644_Rwg20A
Phaeophorbide a monooxygenase (PaO)
ATCGCTTCGTCTTGGCATTT TCTATCCATCATCTGGCGTTTG
CL4383.Contig 1
Phytoene synthase (PSY)
GGAATTTGGGCTTGTTGAGTG TTGCGGAGTTATGTGGGATG