Skip to main content

Table 1 The quantitative PCR primers of putative genes

From: Revealing proteins associated with symbiotic germination of Gastrodia elata by proteomic analysis

Gene ID Forward primer (5′–3′) Reverse primer (5′–3′)
18S rRNA CCAGGTCCAGACATAGTAAG GTACAAAGGGCAGGGACGTA
c48836 AACCTCTTCCGCCATACCTGC GCTCTCCGCTTCAACTGACCA
c54199 GGCGTTGTGGAGAGCATTGGA TTTGTCCGTGCCATGCCTTTCA
c81881 ATGCCGCCTCGTGGAAGACA GTTGAGACCGCTGCCCGTTTAG
c51606 CCAATCGCAGTGCCAGTTCTTC AGAGCATCCTGTGTTCCGTTGT
c81941 GATGCGGCACAAGGAGACCAA TGAGTCGTCGTCAGCACTACCT
c47345 GTCTCAGCGAGCAACAGATGGT GCGAGCAAAGAGCAAGCACAT