Skip to main content

Table 2 Primer sequences and product sizes of sex-specific genes, sex-based divergent genes MAT3 and LEU1S (Fig. 4b), and ACTIN gene

From: Morphology, taxonomy and mating-type loci in natural populations of Volvox carteri in Taiwan

Gene name [Accession number] Primer name Primer sequence (5′ to 3′) Product size (bp)
MID1m [GU784916] MID1-F1 GCTGAAGGAGTGTATCGACGCATT 287
MID1-R1a GCTGCCTGCAAATTCGCTTAAGGT
HMG1f [GU784915] HMG1-1F GACTGCTCACCTATCAGTTGGTCA 326
HMG1-1Ra TTGCCACCTCGTATGCATCGAAGT
MAT3f [GU784915] MAT3f-F AATCGCATGCAGCGCGCACTTTCT 404
MAT3f-Ra TCAGCTGCCAGGCTGGCAGTTATG
MAT3m [GU784916] MAT3 m-F GTGCGCATGCAACGTGCGCTTGAC 401
MAT3 m-Ra TCAGCTGCAAGGTTAGCCGTCCTC
FSI1f [GU784915] FSI-1-F ATGCAGCGGATTGAGATGGCCTTC 428
FSI-1-Ra ATCACCTCTGTACAGGTCGCCTCC
MTM0946 [GU784916] MTM-946-F GCCAACCAACCCGTTCCCAGCATA 420
MTM-946-Ra GCCCTGGACGACTCTAGGGGTCTT
MTF0821 [GU784915] MTF-0821-F GTCGGGCTCATCAGTAAAAGCTGG 358
MTF-0821-Ra GTTCGCCAAGGAACCGAGCTTAAC
LEU1Sm [GU784916] LEU1Sm-F ATGCAGTTTCAGGTCCTAAGGGCT 451
LEU1Sm-Ra CACGTACAGAGTTTCCAAGCCGCT
MTF0991 [GU784915] MTF0991-1F ATGAACACATGCCCATCCTGGTGC 396
MTF0991-1Ra TCAAGGCGCTGCATCGCTGCTACT
MTF2030 [GU784915] MTF2030-1F ATGGCAAACGCAGACCCTGGTACA 464
MTF2030-2Ra CCCTTGCGCCTGCCAGCAGACCCA
ACTIN [XM_002955490] VxCnAct-F2 GAAGCTCTGCTATGTGGCGCTGGA 410b
VxCnAct-R3a ATGGTCGTTCCACCAGAGAGCACG
  1. a Reverse primer
  2. b Determined in the present study