Skip to main content

Table 1 Oligonucleotide primers used in this study

From: Nuclear dynamics in the homothallic ascomycete Sordaria fimicola

Primer Sequence (5′–3′) Purpose
WC33 TCCGTAGGTGAACCTGCGG ITS1F
WC35 TCCTCCGCTTATTGATATGC ITS4R
WC601 ATGGTGAGCAAGGGCGAGGAGGATAA mCherryF
WC602 CTACTTGTACAGCTCGTCCATGCC mCherryR
WC1218 CAGGTCTACAACCGTGATTA PR27pF
WC2902 TTTGAAGATTGGGTTCCTAC PR27pR
WC2903 GTAGGAACCCAATCTTCAAAATGCCTCCCAAGCCCGCCGAC SfcH2BF
WC2904 TCCTCCTCGCCCTTGCTCACCATTTTCGTGCTGGAGGAGTACTTG SfcH2BR
WC2905 CATGGACGAGCTGTACAAGTAG CACTTAACGTTACTGAAATCAT TrpCF
WC2906 GATCCTCTAGAAAGAAGGAT TrpCR