Skip to main content

Advertisement

Table 5 Details of ten primers that target the most divergent regions in the chloroplast genomes of Senecioneae species

From: Comparative genomics of 11 complete chloroplast genomes of Senecioneae (Asteraceae) species: DNA barcodes and phylogenetics

OrientationPrimersTmTarget regionExpected product size
FAAATAGGAGGAAGCTGTGAC55trnH-psbA603
RGCACTATGGCTTTCAACCTA55  
FCACGTCAGATGTTCTATGGA55ndhD-ccsA658
RTTGGGCCTTTATTACTTGGA55  
FTTTGCGAAAAGAGGAAGACA55trnT-trnL812
RTCCATACCAAGGCTCAATTC55  
FTGTGGTAATTGCGTTGAGTA55ndhI-ndhG759
RTACGTAAATAAGGAGCTGCG55  
FCTTGCTTGTACCTACCCAAT55trnS-rps4588
RTGACTCTTCAAGCATTCCAA54  
FTTGACCTTGAAACAACAACG55rps18-rpl20546
RACAAGAGACAGTTGCTTCTT55  
FGGAACTAAAATGAACAGTGCA54psbM-trnD880
RATGTCTACGCTGGTTCAAAT55  
FGCGGATTCTAAATTGTAACCA54ndhC-trnV959
RAGCCCTAGAGCCCTATAAAA55  
FTAACGCTGCCAAATATCCTT55rpl32-ndhF1194
RAGAAGAAGTCCCAACCCTAT55  
FATTGCCACTTCATCAATCTT53psbZ-trnG-617
RACTACACTATGACGGCTAAC54  
  1. Tm annealing temperature, F forward primer, R reverse primer