Skip to main content

Advertisement

Table 5 Details of ten primers that target the most divergent regions in the chloroplast genomes of Senecioneae species

From: Comparative genomics of 11 complete chloroplast genomes of Senecioneae (Asteraceae) species: DNA barcodes and phylogenetics

Orientation Primers Tm Target region Expected product size
F AAATAGGAGGAAGCTGTGAC 55 trnH-psbA 603
R GCACTATGGCTTTCAACCTA 55   
F CACGTCAGATGTTCTATGGA 55 ndhD-ccsA 658
R TTGGGCCTTTATTACTTGGA 55   
F TTTGCGAAAAGAGGAAGACA 55 trnT-trnL 812
R TCCATACCAAGGCTCAATTC 55   
F TGTGGTAATTGCGTTGAGTA 55 ndhI-ndhG 759
R TACGTAAATAAGGAGCTGCG 55   
F CTTGCTTGTACCTACCCAAT 55 trnS-rps4 588
R TGACTCTTCAAGCATTCCAA 54   
F TTGACCTTGAAACAACAACG 55 rps18-rpl20 546
R ACAAGAGACAGTTGCTTCTT 55   
F GGAACTAAAATGAACAGTGCA 54 psbM-trnD 880
R ATGTCTACGCTGGTTCAAAT 55   
F GCGGATTCTAAATTGTAACCA 54 ndhC-trnV 959
R AGCCCTAGAGCCCTATAAAA 55   
F TAACGCTGCCAAATATCCTT 55 rpl32-ndhF 1194
R AGAAGAAGTCCCAACCCTAT 55   
F ATTGCCACTTCATCAATCTT 53 psbZ-trnG- 617
R ACTACACTATGACGGCTAAC 54   
  1. Tm annealing temperature, F forward primer, R reverse primer