Skip to main content

Table 1 Sequences of primers used in this study

From: Chitosan enhances rosmarinic acid production in shoot cultures of Melissa officinalis L. through the induction of methyl jasmonate

Gene namePrimer sequence (5′–3′)Product lengthEfficiency (%)PCR correlation coefficient (R2)
β-ActinActin-f TGTATGTTGCCATCCAGGCCG
Actin-r AGCATGGGGAAGCGCATAACC
0.99698.2128
RASRAS-f ACGCCCCGACCTCAACCTTATC
RAS-r AAGTGGTGCTCGTTTGCCACG
0.99197.4128
PAL1PAL-f GCCGAAGTCATGAACGGAAAGC
PAL-r CGCAGCCTTAACATAACCGCTC
0.99696.8128
TATTAT-f CCTACAAGCTACCAGCCGACTC
TAT-r AGCCCGTAGATTGGGAAACACG
0.99396.1120
OPR3OPR3-f TGCGGGAACCCTGCGGAATA
OPR3-r ATGCAGAGCGCTGAACGCCA
0.99196.5126
RBOHRBOH-f ATTGGAGCAATGGCGGCGCT
RBOH-r AGTGTTGCGGCACATCGGCA
0.99696.3159