Skip to main content

Table 2 Gene-specific primer sequences of CIA2-interacting proteins used in this study

From: Sequence analysis and protein interactions of Arabidopsis CIA2 and CIL proteins

Protein (Restriction enzyme) Forward primers (5′ to 3′)a Reverse primers (5′ to 3′)
ABI3 (BamHI and SalI) CGGGATCCCGATGAAAAGCTTGCATGTGGC GCGTCGACTCATTTAACAGTTTGAGAAGTTGG
ARR3 (NcoI and BamHI) CGCCATGGCCAAAGACGGTGGCGTTTC CGGATCCCTAAGCTAATCCGGGACTCCTC
CO (SmaI and BamHI) CGCCCGGGGATGTTGAAACAAGAGAGTAACGAC GCGGATCCTCAGAATGAAGGAACAATCCCATATC
CIA2 (NcoI and SmaI) CGCCATGGAGATGTCGGCGTGTTTAAGCAGCG CGCCCGGGTTATCTTTGTCCACTTGGAGTG
CIL (NcoI and SmaI) CGCCATGGAGATGTCCTCTTGTGCCTATAGC CGCCCGGGTAATCGTAGACCACTTAAATTCC
NF-YB1 (NcoI and EcoRI) CATGCCATGGCGGATACGCCTTCGAG GGAATTCTTACCAGCTCGGCATTTCTTCA
NF-YC1 (NcoI and EcoRI) CATGCCATGGATACCAACAACCAGCAAC GGAATTCTTAACCTTGGCCGTCGAG
NF-YC9 (BamHI and SalI) CGGGATCCGAATGGATCAACAAGACCATGG GCGTCGACTAATTTTCCTGGTCAGGTTGG
  1. aThe underlined sequences are additional restriction sites