Skip to main content

Table 1 Genomic sequences flanking COKC insertion in transgenic rice plants

From: Application of an inducible transposon with anther culture in generation of di-haploid homologous mutants

Line Chromosome/BACs Insertion position (bp) GenBank accession no. Identities Primers
COKC specific Site specific
K19-H3 8/OSJNBa0095C12 46381 AY360385 231/231 (100%) GGTATTTCTTACATGGGCTG GCCTTTTGACATGTAGCG
GTCATACATTCTGATCATGAG
K19-C2 2/OSJNBa0091C16 141691 AP005820 198/200 (99%) GGTATTTCTTACATGGGCTG GCCGGTGGAGTGTCCTCCG
GGTCGGCCTTGTTCGAGCG
K19-H5 10/OSJNBa0094J09 56754 AC078839 89/89 (100%) GGTATTTCTTACATGGGCTG GCCATAGCAAAGATCAGATC
GAAATCTATTGCGTGCCAG
K17-H3 7/P0045F02 30502 AP004268 344/344 (100%) GGTATTTCTTACATGGGCTG CATAAGTTGTAGCAAAGCATAC
ATTCATTTCATCTCTCAATTA
K20-H6 1/OSJNOa264G09 14881 AP008219 256/256 (100%) GGTATTTCTTACATGGGCTG GCTGAAGACATTCAGAGGGAG
CTGCAGAAAATAAGCATATT
K24-C2 12/OSJNBa0037B01 58801 AL928751 155/155 (100%) GGTATTTCTTACATGGGCTG CTGATGAGCAAGAGAAAAAG
CCGCCTCCTGGTCAGCTC
  1. Primers for determining the COKC homogeneity of each insertion line are indicated.