Skip to main content

Table 1 qRT-PCR primer sequence

From: Expression of ovate family protein 8 affects epicuticular waxes accumulation in Arabidopsis thaliana

Gene Primer name Primer sequence (5′–3′)
LTP4 LTP4-F CACCTCCGTGCTGTGCAG
LTP4-R TGGCGCAGTTGGTGCTC
At2g18370 At2g18370-F GCATCAAGTCAGTGGCTAATAGTGT
At2g18370-R CATTCGCCTACATATATTATACGGC
CER4 CER4-F TTGATGCTGTTTCTGATGTGATGC
CER4-R ACGACCTTCCCTTCTTTGTTGG
KCS2 KCS2-F GGTTGTAGTGCTGGTCTTATCTCC
KCS2-R GGACGGTGTGGATGAGTTGG
ADH1 ADH1-F ATGCCTTCAAGACTCATCCGA
ADH1-R TTGATTTCCGAGAATGGCACT
KCS10 KCS10-F CTCGACGTCAGTTTAATGCATCT
KCS10-R GGGTTCTTGGTAGCGTATTCGT
FAR4 FAR4-F CACAATGGCTCAGTTCAGTTTCTAC
FAR4-R CGCAGTTTCTCAGTATTCGTATCG
GL2 GL2-F TAGAGATGAAGCTCGTCGGCAT
GL2-R GTTGCCTCTGTCTTGTCCCTT
DFR DFR-F GGTTACTTTGTTCGTGCCACC
DFR-R CCTCAGATAAATCAGCCTTCC
At2g42990 At2g42990-F GCCTCGAAAAGATGTGAAGAG
At2g42990-R TGAATTCTTAACACGCCAGAGG
At1g06360 At1g06360-F GACCCACATAGCCCTATCGAA
At1g06360-R TGCTTCAAGTCCATCACGTT
CER2 CER2-F CGAGCCGTCTACTTCTTCAAGG
CER2-R GTTGCAGCGAATGTAAGGTATGG
ACT2 ACT2-F CCAGAAGGATGCATATGTTGGTGA
ACT2-R GAGGAGCCTCGGTAAGAAGA