Botanical Studies

An International Journal

Impact Factor 1.452

Botanical Studies Cover Image
Open Access

Screening transferable microsatellite markers across genus Phalaenopsis (Orchidaceae)

Botanical StudiesAn International Journal201758:48

https://doi.org/10.1186/s40529-017-0200-z

Received: 24 August 2017

Accepted: 4 November 2017

Published: 15 November 2017

Abstract

Background

Molecular identification based on microsatellite loci is an important technology to improve the commercial breeding of the moth orchid. There are more than 30,000 cultivars have been enrolled at the Royal Horticultural Society (RHS). In this study, genomic microsatellite primer sets were developed from Phalaenopsis aphrodite subsp. formosana to further examine the transferability of across 21 Phalaenopsis species.

Methods and results

Twenty-eight polymorphic microsatellite markers were obtained using the magnetic bead enrichment method, with high transferability of the 21 species of the genus Phalaenopsis, especially in the subgenus Phalaenopsis. The 28 newly developed polymorphic microsatellite markers with high polymorphism information content values. The best and second fit grouping (K) are inferred as two and four by the ΔK evaluation in the assignment test. This result indicates that these microsatellite markers are discernible to subgenus Phalaenopsis.

Conclusions

Our results indicate that these new microsatellite markers are useful for delimiting species within genus Phalaenopsis. As expected, the genetic relationships between species of subgenus Phalaenopsis can be well distinguished based on the assignment test. These molecular markers could apply to assess the paternity of Phalaenopsis as well as investigating hybridization among species of genus Phalaenopsis.

Keywords

Phalaenopsis MicrosatellitesPolymorphismTransferability

Background

The subtropical Taiwan Island that is situated off the southeastern Asian continent has well-suited climate conditions for the growth of orchids. Since the high quality of breeding and micropropagation technology coupled with market demands of the orchid genus Phalaenopsis Blume (Orchidaceae), Taiwan has become one of the important exporting countries of orchids in the world (Chen and Chen 2007, 2011; Tang and Chen 2007). The genus Phalaenopsis belongs to the family Orchidaceae, subfamily Epidendroideae, tribe Vandeae and subtribe Aeridinae (Dressler 1993), which is often known as moth orchid and comprises approximately 66 species (Christenson 2001). Phalaenopsis species is broadly distributed across Himalayas of northern India, South India, Sri Lanka, Southeast China, Taiwan, Indonesia, Thailand, Myanmar, Malaysia, the Philippines, Papua New Guinea and northeastern Australia (Chen and Chen 2011; Christenson 2001). According to the pollinia numbers (Christenson 2001) and molecular evidences (Tsai et al. 2010), Phalaenopsis can be divided into five subgenera: the four pollinia clades of subgenera Proboscidioides, Aphyllae, and Parishianae and the two pollinium clades of subgenera Polychilos and Phalaenopsis. Among these subgenera, the Polychilos and Phalaenopsis was each subdivided into four sections Polychilos, Fuscatae, Amboinenses, Zebrinae and Phalaenopsis, Deliciosae, Esmeralda, Stauroglottis, respectively (Dressler 1993; Christenson 2001).

The species of genus Phalaenopsis are most popular epiphytic monopodial orchids for their distinctive and varied flowers with the unique structure. Horticultural breeding by hybridization remixed floral characters, such as the colors, shapes, and sizes, to create diversified varieties and cultivars. Based on the high breeding and cultivation techniques for the regulation of light and feeding and the development in interspecific and intergeneric hybrids breeding and polyploidy, improvement of the long-lasting quality of the floral traits made Phalaenopsis as one of an important orchid source for cut-flower crop.

There are two indigenous species of Phalaenopsis native to Taiwan, the P. aphrodite subsp. formosana and P. equestris (Chen and Wang 1996). Both species were classified as the section Phalaenopsis (Christenson 2001). Phalaenopsis aphrodite subsp. formosana, commonly known as the Taiwan moth orchid, has been widely used as an important breeding hybrids parent, and it is one of the most important progenitors for the traits of modern large and white of floral organs commercial hybrids breeding (Tanaka et al. 2005). Phalaenopsis equestris is another important breeding parent for the miniature type of multi-flowers and artificial hybrids with white petals and sepals and a red lip (Men et al. 2003; Tang and Chen 2007).

Recently, intergeneric hybrids between Phalaenopsis and Ascocenda cultivars were developed to introduce orange color into hybrid cultivars (Liu et al. 2016). However, complex phenotype and long stage of juvenile make the identification of varieties and cultivars of Phalaenopsis plants difficult and time consuming. In addition, traditional horticultural breeding technique for new cultivars of Phalaenopsis by integrating the morphology, physiological development, and environmental factors as well as their complex interactions makes the breeding consequence unpredictable and uncertain. Molecular markers can provide sensitive and accurate tools for identifying species and cultivars. Therefore, development of highly reliable, rapid, and cheap technique for differentiating and identifying seedlings of species and cultivars of Phalaenopsis is necessary and useful for enhancing the efficiency of the breeding. Furthermore, development of molecular markers could apply to paternity analysis, phylogenetic reconstruction, and resolving long-standing issues on Phalaenopsis breeding. Microsatellite markers with characteristics of high level of polymorphism, codominant inheritance and reproducibility (Powell et al. 1996) are useful tools for application in plant genetics and crop breeding, including fruit tree (Chiang et al. 2012; Chiou et al. 2012; Tsai et al. 2013; Lai et al. 2015) and orchid (Tsai et al. 2014, 2015). Compared to previous studies (Sukma 2011; Tsai et al. 2015), we intend to use more microsatellite loci as well as more extensive species testing in this study to enhance the discriminatory power between Phalaenopsis genus.

The genome size is small for P. aphrodite subsp. formosana (Hsiao et al. 2011) and roughly 2.81 pg in diploid genome (Chen et al. 2013), which is suitable for the development of microsatellite markers. Here, the objective of this study was to develop transferable microsatellite markers from P. aphrodite subsp. formosana using the modified magnetic bead enrichment method. Based on these transferable markers, the molecular identification systems is able to be established for accessing the hybridization and introgression among species of the genus Phalaenopsis in future work.

Materials and methods

Plant materials

There are 21 species of the genus Phalaenopsis comprised of five subgenera used in this study. The taxonomy and nomenclature are followed (Christenson 2001), and specimens information are listed in Table 1. All samples were collected from the plants planted in the greenhouse at the Kaohsiung District Agricultural Improvement Station (KDAIS) in Taiwan by C. C. Tsai. Voucher specimens were deposited in herbarium of the National Museum of Natural Science, Taiwan (TNM).
Table 1

Information on geographic distribution, species code and voucher specimens of the genus Phalaenopsis used in this study

Classification

Geographical distribution

Code

Sourcea

Subgenus Proboscidioides (Rolfe) E. A. Christ.

 P. lowii Rchb.f.

Myanmar, and adjacent western Thailand

P4

KDAIS-KC88

Subgenus Aphyllae (Sweet) E. A. Christ.

 P. minus (Seidenf.) E. A. Christ.

Endemic to Thailand

P11

KDAIS-KC227

 P. braceana (J. D. Hook.) E. A. Christ.

Bhutan and China

P13

KDAIS-KC289

Subgenus Parishianae (Sweet) E. A. Christ.

 P. parishii Rchb.f.

Eastern Himalayas, India, Myanmar, and Thailand

P15

KDAIS-KC316

Subgenus Polychilos (Breda) E. A. Christ.

 P. mannii Rchb.f.

Northeast India, Nepal, and China to Vietnam

P18

KDAIS-KC22

 P. cornu-cervi (Breda) Bl. and Rchb.f.

Northeast India and the Nicobar Islands to Java and Borneo

P2

KDAIS-KC23

 P. kunstleri J. D. Hook.

Myanmar and Malay Peninsula

P8

KDAIS KC-139

 P. pulchra (Rchb.f.) Sweet

Endemic to the Philippines (Luzon and Leyte)

P1

KDAIS-KC17

 P. violacea Witte

Indonesia (Sumatra) and Malaysia (Malay Peninsula)

P9

KDAIS-KC153

 P. micholitzii Rolfe

Philippines (Mindanao)

P19

KDAIS-KC382

 P. maculata Rchb.f.

Malaysia (Pahang), East Malaysia (Sabah and Sarawak), and Indonesia (Kalimantan Timur)

P3

KDAIS-KC49

 P. amboinensis J. J. Sm.

Indonesia (Molucca Archipelago and Sulawesi)

P17

KDAIS-KC157

 P. inscriptiosinensis Fowlie

Endemic to Indonesia (Sumatra)

P14

KDAIS-KC298

 P. corningiana Rchb.f.

Borneo (Sarawak and elsewhere on the island)

P16

KDAIS-KC346

Subgenus Phalaenopsis

 P. amabilis (L.) Blume

Widespread from Sumatra and Java to the southern Philippines, east to New Guinea and Queensland, Australia

P5

KDAIS-KC23

 P. aphrodite Rchb.f.

Northern Philippines and southeastern Taiwan

PN

KDAIS-KC96

 P. schilleriana Rchb.f.

Endemic to the Philippines

P10

KDAIS-KC429

 P. chibae Yukawa

Yukawa endemic to Vietnam

P20

KDAIS-KC488

 P. pulcherrima (Lindl.) J. J. Sm.

Widespread from northeast India and southern China throughout Indochina to Malaysia (Malay Peninsula), Indonesia (Sumatra), and East Malaysia (Sabah)

P12

KDAIS-KC256

 P. equestris (Schauer) Rchb.f.

Philippines and Taiwan

P7

KDAIS-KC203

 P. lindenii Loher

Endemic to the Philippines

P6

KDAIS-KC119

aPlant materials were cultivated at the Kaohsiung District Agricultural Improvement Station, Taiwan and voucher specimens were deposited at the herbarium of the National Museum of Natural Science, Taiwan

Screening, sequencing microsatellite loci, and primer designation

Total DNA was extracted from tissue culture seedlings or young leaves following the procedure by a Plant Genomic DNA Extraction Kit (RBC Bioscience, Taipei, Taiwan). The DNA sample from P. aphrodite subsp. formosana was screened for microsatellites by digested with the restriction enzyme MseI (Promega, Madison, Wisconsin, USA) and confirmed with 1.5% agarose gel electrophoresis. The digested fragment sizes with a range from 400 to 1000 bps were extracted using agarose gel and then ligated with MseI-adapter pair (5′-TACTCAGGACTCAT-3′ and 5′-GACGATGAGTCCTGAG-3′) using DNA T4 ligase. As the template DNA for the enrichment of the partial genomic library, the ligated products were then used to perform 20 cycles of pre-hybridization PCR amplification in a 20 μL reaction mixture using the adapter specific primer (MseI-N: 5′-GATGAGTCCTGAGTAAN-3′). The PCR mixture contained 20 ng template DNA, 10 pmol MseI-N, 2 μL 10× reaction buffer, 2 mM dNTP mix, 2 mM MgCl2, 0.5 U Taq DNA polymerase (Promega), and sterile water was added to total volume of 20 μL, with the PCR program of initial denaturation of 94 °C for 5 min, followed by 18 cycles of 30 s at 94 °C, 1 min at 53 °C, 1 min at 72 °C, and a final extension at 72° C for 10 min using a Labnet MultiGene 96-well Gradient Thermal Cycler (Labnet, Edison, New Jersey, USA). The biotinylated oligonucleotide repeat probes (AG)15, (AC)15, (TCC)10, and (TTG)10 were used to hybridize with the amplicons at 68 °C for 1 h. The hybridization mixture was then enriched using 1 mg of streptavidin magnesphere paramagnetic particles (Promega) at 42 °C for 2 h and then eluted. Subsequently, DNA fragments containing microsatellites were purified and then amplified by 25-cycle-PCR using purified captured DNA fragments as templates (5 μL), MseI-N (10 pmol), 10× reaction buffer (2 μL), dNTP mix (2 mM), MgCl2 (2 mM), 0.5 U Taq DNA polymerase (Promega), and supplement sterile water to 20 μL under the amplification conditions described above. The PCR products were purified by the HiYield™ Gel PCR DNA Fragments Extraction Kit (RBC Bioscience) and used for cloning. The purified DNA was ligated into the pGEM®-T Easy Vector System (Promega), and used to transformed into E. coli DH5α competent cells. The positive clones were randomly selected and used for sequencing. In total, 321 positive colonies were collected and amplified with T7 and SP6 primers and sequenced on an ABI PRISM 3700 DNA Sequencer (Applied Biosystems, Foster City, California, USA). Sequences containing microsatellites were detected using Tandem Repeats Finder version 4.09 (Benson 1999), and primer pairs were designed for microsatellite loci with suitable flanking regions to amplify using FastPCR software version 6.5.94 (Kalendar et al. 2009). Each primer pairs were designed to amplify with a fragment in the range of 100–400 bp.

Microsatellites PCR amplification

To verify the effectiveness and polymorphisms of 28 microsatellite loci, all primer pairs designed for amplifying these microsatellites were tested using the P. aphrodite subsp. formosana DNA samples together with the other 20 Phalaenopsis species. The optimal annealing temperature was determined using gradient PCR on a Labnet MultiGene 96-well Gradient Thermal Cycler (Labnet). The PCR was carried out in a total reaction volume of 20 μL, in which the PCR reaction mixtures contained 20 ng template DNA, 0.2 μM forward and reverse primers, 2 μL 10× reaction buffer, 2 mM dNTP mix, 2 mM MgCl2, and 0.5 U of Taq polymerase (Promega). The gradient PCR protocol was set at 94 °C for 5 min, followed by 35 cycles of 94 °C for 40 s, a temperature gradient 50–60 °C for 60 s, 72 °C for 60 s, and a final step of 72 °C for 10 min. Then, the PCR products were assessed using 10% polyacrylamide gel electrophoresis and stained with ethidium bromide and visualized (EtBr) under UV light exposure. The patterns and length of alleles were recorded digitally by Quantity One ver. 4.62 (Bio-Rad Laboratories, Hercules, California, USA).

Data analyses

In total, 146 repeatable amplicons with length variation were screened from 28 microsatellite primer pairs (Table 2) in 21 species (Table 1). The number and average of amplicons (alleles) per primer pairs and the polymorphism information content (PIC) value of each loci were estimated using Power-Marker version 3.25 (Liu and Muse 2005). The Bayesian clustering method was used to estimate genotyping group information and genetic components for 21 Phalaenopsis taxa with the assistance of STRUCTURE ver. 2.3.4 (Pritchard et al. 2000; Falush et al. 2003, 2007). The admixture model (Hubisz et al. 2009) was selected in the Bayesian clustering analysis. The posterior probability of the genetic grouping number (K = 1–21) was estimated using the Markov chain Monte Carlo (MCMC) approach and 10 independent runs with a first 10% discarding (burnin) followed by 5,000,000 MCMC steps for each grouping number. The first-two best grouping numbers were evaluated using ΔK process (Evanno et al. 2005) by STRUCTURE HARVESTER ver. 0.6.8 (Earl and vonHoldt 2012). The graphical display of the results was drawn by DISTRUCT program (Rosenberg 2004).
Table 2

Characteristics of the 28 polymorphic microsatellite primers derived from Phalaenopsis aphrodite subsp. formosana

Locus

Primer sequences (5′–3′)

Repeat motif

Allelic size (bp)

Annealing temperature (°C)

No. of alleles

PIC

PA5-1

F: TCCCATTATCACTCCCTCAC

(TC)14

140–164

59

4

0.67

R: GGTTAGAGATATAGGGAGAG

PA5-2

F: CTCTCTTTCCTTCTCACCTC

(TC)10

98–104

58

4

0.61

R: AAGATAGAGGGAGAGAGTGG

PA7

F: CTCTGCTTCTCACCTTTCAC

(TC)12

116–264

56

3

0.55

R: GGACAGAAAGTGAGAGAGAG

PA10

F: TCTTCAGTCCCTCACTCATC

(CT)14

132–152

58

7

0.75

R: ACAAAGCGGTGGAGAATATG

PA11

F: ATCTATTGCTCTTTGTCCTC

(CT)42

214–216

55

2

0.38

R: TAGCAAAGAGATGCTGAAGG

PA14

F: TTTTCACTCTCCCTCCATCC

(CT)21

182–186

52

3

0.55

R: GATGTAGAGAATGAGGGAGC

PA15

F: TCTCCTACTCCCTCTATCTCA

(CT)25

306–310

56

3

0.55

R: CTTGAAAGGCAGAGAGATAG

PA19

F: TCTCCCTATATCTCTGCATC

(CTCC)4

154–158

51

3

0.58

R: TGGAAAGAGAAAGGTTCAGG

PA21

F: TCTCTCACTTTGTCACTCGC

(CT)14

134–146

57

6

0.77

R: AAAGGGAAGTAGGGAAGGAG

PA24

F: TTGATCTCTCTGGCACCCAC

(TC)36

216–224

55

3

0.59

R: AAGAGAGAGTTAGTTGGAGAT

PA25-1

F: ACCCACTTTCTCCTATCTCC

(CT)20

176–202

58

5

0.64

R: GATGAAAGAGAGTGAGAGCG

PA25-2

F: TCTCCCTCTCTTTACCACTC

(CT)12

92–267

58

6

0.73

R: GTGAGAGAGATAGAGTGAGC

PA32-1

F: CTCTTCCTGCTTTTCCTAGG

(CT)25

148–222

57

8

0.83

R: AAGAGGGTGTGAGGAAGAGG

PA32-2

F: TCTCTCACTACTCTATCTTG

(CT)18

140–152

54

5

0.73

R: GAGAAGATAGAAAGAGTGAG

PA36

F: CTCCACTTTATCTCTCTACC

(TC)39

220–250

55

4

0.67

R: ATTGAGCGAGATAAAACTAG

PA37

F: TTTACCTCTTTTGCTAGCTC

(TC)23

226–234

50

4

0.67

R: AAGAGAAAGGGAAGGAGAGC

PA38

F: CTCTCTCACTCTATTACTCC

(CT)32

224–384

54

9

0.84

R: AGCTAGATAGAGGGAGAAAG

PA40

F: GAGCAACATTCACTAGAGAG

(CA)14

258–320

56

6

0.79

R: CTGGCAAAGCTTTGAGAAGG

PA41

F: GAGGAGAAATAATGATTCCG

(AG)12

138–140

50

2

0.38

R: AGACACTCTCACACACTTTC

PA63

F: TTCATTCCATCTACCCCATC

(CT)8

130–136

55

3

0.59

R: GATAGAAAGACTAGAGTAGG

PA64

F: CTCTCCTTTTTCTTATCTTTCAC

(CT)94

248–296

55

3

0.55

R: TAGAGAGATAGAGGGCAAGC

PA74-1

F: AATGACCTCTCTGCTCTCTC

(TC)28

172–306

50

3

0.59

R: GCAAGAGAAGTTGTGGGATGG

PA74-2

F: CATCCCACAACTTCTCTTGC

(CT)13

122–134

55

5

0.58

R: AGTGCTCAAGCGAGTTAGAGAC

PA83-1

F: CCCTCTTTCTCTCATTGTCC

(TC)9

190–198

54

2

0.35

R: GGGACAGAGTGCATAAGATG

PA83-2

F: CCTTATCTCTTCTCTCTACC

(TC)36

168–210

50

12

0.87

R: AGAAAGGAAGGGTAGGAGAG

PA100-1

F: TCCCTCTATTTTAGACACCC

(TC)11

132–136

52

2

0.35

R: GGAGAAAGAGCAAGACAGTG

PA100-2

F: TCTCCATCCGTTAGCCTCTC

(CT)16

128–136

59

5

0.73

R: GGGTAGGCAGAGAGAGTGAT

PA101

F: CCCACTCACACTCTATCTTC

(TC)11

126–138

55

7

0.63

R: AGGGTCAAACAGAATGAAGG

    

Average

4.57

0.63

Results and discussion

All of 21 Phalaenopsis species reveal either zero, one or two PCR amplicons in each of 28 microsatellite loci. One or two PCR amplicons per locus represent homozygotes or heterozygotes, and no amplicon indicate lacking this homologous microsatellite locus (Table 2). The genome size of Phalaenopsis aphrodite subsp. formosana detected by flow cytometry reveals roughly 2.81 pg in diploid genome (Chen et al. 2013) and all diploid species of Phalaenopsis have 38 chromosome number (Christenson 2001). These related studies and our current results indicate that 21 Phalaenopsis taxa studied are diploid plants, except the P. lowii and P. minus are not listed in the study of Chen et al. (Christenson 2001; Chen et al. 2013).

In total, 146 amplicons (alleles) were identified by 28 microsatellite primer pairs across 21 native Phalaenopsis species, and the number of amplicons per primer pairs ranged from 2 to 12, with an average of 5.21 (Table 2). The cross-species amplification test for the 20 other species was conducted using 28 microsatellite primers developed by P. aphrodite subsp. formosana, and the species of P. amabilis (L.) Blume, P. schilleriana Rchb.f, P. chibae, P. equestris (Schauer) Rchb.f. and P. lindenii Loher have higher transferable loci. The above mentioned four species with P. aphrodite subsp. formosana are all classified under the genus Phalaenopsis. The microsatellite primers could be successfully transferable to an average of 6.21 species [range from two (PA7, PA11 and PA41) to 20 (PA101) species] (Table 3). Due to the high transferability to species of the subgenus Phalaenopsis, these newly developed microsatellite primers are able to apply to establish a standard molecular identification operating system in Phalaenopsis.
Table 3

The result of the 28 polymorphic microsatellite loci isolated from Phalaenopsis aphrodite subsp. formosana test on 21 samples

Locus

PN

P1

P2

P3

P4

P5

P6

P7

P8

P9

P10

P11

P12

P13

P14

P15

P16

P17

P18

P19

P20

IS

PA5-1

O

O

O

O

O

O

6

PA5-2

O

O

O

O

E

5

PA7

E

O

2

PA10

O

O

O

E

E

O

E

O

O

O

O

O

12

PA11

O

O

2

PA14

O

O

O

O

4

PA15

O

O

O

O

4

PA19

O

O

O

O

O

O

O

O

8

PA21

O

O

O

O

O

O

O

O

E

O

O

11

PA24

O

O

O

3

PA25-1

O

O

O

O

O

O

E

O

8

PA25-2

O

E

O

E

E

5

PA32-1

E

O

O

O

O

O

O

O

8

PA32-2

O

O

E

O

O

E

6

PA36

O

O

O

O

O

5

PA37

O

E

O

3

PA38

O

O

O

O

O

E

O

O

E

9

PA40

E

O

O

E

4

PA41

O

O

2

PA63

O

O

O

3

PA64

O

O

O

E

4

PA74-1

O

O

O

2

PA74-2

O

O

O

O

E

E

6

PA83-1

O

O

O

3

PA83-2

E

O

O

E

O

O

O

E

O

O

E

O

E

E

14

PA100-1

O

O

O

O

O

O

6

PA100-2

O

O

O

O

O

O

O

O

O

9

PA101

O

O

O

O

O

O

E

E

O

O

O

O

O

O

O

O

O

O

O

O

20

IL

28

4

4

4

6

13

18

20

11

2

16

5

5

1

4

5

4

1

8

4

12

 

IS the number of successful amplified species, IL the number of successful amplification primer, O homozygote, E heterozygote

The allelic polymorphism information content (PIC) values reflect the extent of allele diversity among the species, the PIC values in the present study ranged from 0.38 to 0.87, with an average of 0.63 (Table 4). Previous studies showed that the PIC values ranged from 0.1754 to 0.6740 (Sukma 2011) and 0 to 0.682 (Tsai et al. 2015) for the genomic microsatellite loci and EST-SSR of Phalaenopsis species, respectively. Thus, the PIC value in our study is greater than previous studies on Phalaenopsis. This PIC result is consistent with genomic microsatellite studies in Scutellaria austrotaiwanensis (Hsu et al. 2009), mango (Chiang et al. 2012), and Indian jujube (Chiou et al. 2012).
Table 4

Proportion of individuals of each pre-defined population in each of the 2 and 4 clusters

 

K = 2

K = 4

Subgenus

Section

Composition 1

Composition 2

Composition 1

Composition 2

Composition 3

Composition 4

P. aphrodite

0.995

0.005

0.625

0.371

0.001

0.002

Phalaenopsis

Phalaenopsis

P. amabilis

0.689

0.311

0.572

0.164

0.238

0.027

Phalaenopsis

Phalaenopsis

P. schilleriana

0.904

0.096

0.800

0.155

0.028

0.017

Phalaenopsis

Phalaenopsis

P. equestris

0.988

0.012

0.824

0.145

0.003

0.029

Phalaenopsis

Stauroglottis

P. lindenii

0.974

0.026

0.231

0.478

0.002

0.288

Phalaenopsis

Stauroglottis

P. chibae

0.529

0.471

0.106

0.133

0.116

0.645

Phalaenopsis

Deliciosae

P. pulcherrima

0.117

0.883

0.047

0.028

0.894

0.031

Phalaenopsis

Esmeralda

P. cornu-cervi

0.009

0.991

0.002

0.002

0.992

0.004

Polychilos

Polychilos

P. mannii

0.313

0.687

0.183

0.054

0.643

0.121

Polychilos

Polychilos

P. kunsteri

0.568

0.432

0.488

0.111

0.391

0.01

Polychilos

Fuscatae

P. violacea

0.016

0.984

0.003

0.002

0.992

0.003

Polychilos

Amboinenses

P. maculata

0.047

0.953

0.01

0.012

0.958

0.02

Polychilos

Amboinenses

P. pulchra

0.032

0.968

0.007

0.004

0.983

0.006

Polychilos

Amboinenses

P. micholitzii

0.239

0.761

0.036

0.058

0.643

0.263

Polychilos

Amboinenses

P. amboinensis

0.007

0.993

0.002

0.002

0.994

0.002

Polychilos

Amboinenses

P. inscriptiosinensis

0.054

0.946

0.01

0.013

0.922

0.055

Polychilos

Zebrinae

P. corningiana

0.028

0.972

0.003

0.024

0.859

0.114

Polychilos

Zebrinae

P. lowii

0.214

0.786

0.063

0.078

0.815

0.043

Proboscidioides

Proboscidioides

P. parishii

0.147

0.853

0.072

0.019

0.887

0.022

Parishianae

Parishianae

P. minnii

0.081

0.919

0.029

0.008

0.957

0.006

Aphyllae

Aphyllae

P. braceana

0.007

0.993

0.002

0.002

0.994

0.002

Aphyllae

Aphyllae

Italic values indicate major component of the species

For genetically delimiting 21 species of the genus Phalaenopsis, a model-based Bayesian clustering algorithm was performed in STRUCTURE 2.3.4. The result showed that the first two best clustering numbers are K = 2 and K = 4 (Table 4). The ΔK was 96.55 and 2.31 when K = 2 and K = 4 in the Bayesian clustering analysis, respectively. Under K = 2, most species of the subgenus Phalaenopsis were assigned to the same cluster with high percent of Component 1 (pink segment in Fig. 1A) except P. pulcherrima that is genetically assigned to sections Esmeralda (subgenus Polychilos). The subgenus Proboscidioides, Aphyllae, and Parishianae, and Polychilos were consigned to the cluster with high percent of Component 2 (green segment in Fig. 1A) except P. kunstleri belonging to subgenus Polychilos which revealed an admixture genetic composition (56.8% of Component 1 and 43.2% of Component 2) (Table 4). When K = 4, Component 1 of K = 2 was divided into three components, 1a (pink segment in Fig. 1B), 1b (orange segment in Fig. 1B), and 1c (purple segment in Fig. 1B) (Table 4). Under K = 4, sections Deliciosae and Esmeralda can be divided into different clusters, which are grouped together when K = 4. Two sections Phalaenopsis and Stauroglottis of subgenus Phalaenopsis were grouped together with high genetic similarity (Table 4 and Fig. 1B). In addition, section Fuscatae of subgenus Polychilos was genetically assigned to the subgenus Phalaenopsis cluster based on both section Fuscatae of subgenus Polychilos belong to pink segment group with more than 50% proportion of Component 1 (see Fig. 1A, B and Table 4). The assignment test by Bayesian clustering analysis reveals similar result with molecular phylogeny patterns described by Tsai et al. (2005). The Bayesian clustering analysis based on EST-SSR loci could not get high resolution between either subgenus or sections within subgenus (Tsai et al. 2015). Compare to EST-SSR results published by Tsai et al. (2015), these newly developed genomic microsatellite loci have higher resolution than EST-SSR loci when study on native moth orchids.
Fig. 1

Genotypic group structure of the genus Phalaenopsis used in this study in K = 2 (A) and 4 (B)

Conclusions

The Phalaenopsis species are important genetic resources for the breeding of hybrids in the horticultural market. The molecular identification markers are an important technology for breeder to improve the commercial cultivars. In this study, we developed 28 primer sets for the polymorphic microsatellite loci of Phalaenopsis aphrodite subsp. formosana, which are highly transferable among related species of the genus Phalaenopsis. Based on these transferable markers, delimitations between subgenera and between sections inferred by the Bayesian clustering analysis indicate that these SSR markers reveal high taxonomic resolution for paternity and hybridization application among genus Phalaenopsis. In this study, we provided useful and cheap DNA barcoding markers for molecular breeding.

Declarations

Authors’ contributions

Conceived and designed the experiments: YZK and YCC. Performed the experiments: YZK, HCS, HHH, and YCC. Analyzed the data: YZK, HHH, and YCC. Contributed reagents/materials/analysis tools: HCS, CCT, HHH, PCL and YCC. Wrote the paper: YZK, PCL and YCC. Conceived of the study, edited the manuscript, and approved the final manuscript: YZK, HCS, CCT, HHH, PCL and YCC. All authors read and approved the final manuscript.

Acknowledgements

Achievement of this study is dedicated to the memory of the scientific contributions of Dr. C. C. Tsai who is the third author. Dr. C.C. Tsai dead on November 05, 2015 in an unexpected stroke. Dr. C.C. This research was supported by funding from the Ministry of Science and Technology, Taiwan, MOST 105-2621-B-110-003-MY3 and MOST 105-2621-B-110-001 to YCC and the Multidisciplinary and Data Science Research Center (MDSRC), NSYSU.

Competing interests

The authors declare that they have no competing interests.

Ethics approval and consent to participate

Not applicable.

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made.

Authors’ Affiliations

(1)
Department of Biological Sciences, National Sun Yat-sen University
(2)
Department of Nursing, Meiho University
(3)
Kaohsiung District Agricultural Research and Extension Station
(4)
National Pingtung University of Science and Technology
(5)
Department of Life Science, National Taiwan Normal University
(6)
Department of Biomedical Science and Environment Biology, Kaohsiung Medical University

References

  1. Benson G (1999) Tandem repeats finder: a program to analyze DNA sequences. Nucleic Acids Res 27(2):573–580View ArticlePubMedPubMed CentralGoogle Scholar
  2. Chen WH, Chen HH (2007) Orchid biotechnology. World scientific Publishing Co. Ltd, SingaporeView ArticleGoogle Scholar
  3. Chen WH, Chen HH (2011) Orchid biotechnology II. World scientific Publishing Co. Ltd, SingaporeView ArticleGoogle Scholar
  4. Chen WH, Wang YT (1996) Phalaenopsis orchid culture. Taiwan Sugar 43:11–16Google Scholar
  5. Chen WH, Kao YL, Tang CY, Tsai CC, Lin TY (2013) Estimating nuclear DNA content within 50 species of the genus Phalaenopsis Blume (Orchidaceae). Sci Hortic 161:70–75View ArticleGoogle Scholar
  6. Chiang YC, Tsai CM, Chen YKH, Lee SR, Chen CH, Lin YS, Tsai CC (2012) Development and characterization of 20 new polymorphic microsatellite markers from Mangifera indica L. (Anacardiaceae). Am J Bot 99(5):e117–e119View ArticlePubMedGoogle Scholar
  7. Chiou CY, Chiang YC, Chen CH, Yen CR, Lee SR, Lin YS, Tsai CC (2012) Development and characterization of 38 polymorphic microsatellite markers from an economical fruit tree, the Indian jujube. Am J Bot 99(5):e199–e202View ArticlePubMedGoogle Scholar
  8. Christenson EA (2001) Phalaenopsis: a monograph. Timber Press, PortlandGoogle Scholar
  9. Dressler RL (1993) Phylogeny and classification of the orchid family. Cambridge University Press, CambridgeGoogle Scholar
  10. Earl DA, vonHoldt BM (2012) STRUCTURE HARVESTER: a website and program for visualizing STRUCTURE output and implementing the Evanno method. Conserv Genet Resour 4:359–361View ArticleGoogle Scholar
  11. Evanno G, Regnaut S, Goudet J (2005) Detecting the number of clusters of individuals using the software structure: a simulation study. Mol Ecol 14:2611–2620View ArticlePubMedGoogle Scholar
  12. Falush D, Stephens M, Pritchard JK (2003) Inference of population structure using multilocus genotype data: linked loci and correlated allele frequencies. Genetics 164:1567–1587PubMedPubMed CentralGoogle Scholar
  13. Falush D, Stephens M, Pritchard JK (2007) Inference of population structure using multilocus genotype data: dominant markers and null alleles. Mol Ecol Notes 7:574–578View ArticlePubMedPubMed CentralGoogle Scholar
  14. Hsiao YY, Pan ZJ, Hsu CC, Yang YP, Hsu YC, Chuang YC, Shih HH, Chen WH, Tsai WC, Chen HH (2011) Research on orchid biology and biotechnology. Plant Cell Physiol 52(9):467–1486View ArticleGoogle Scholar
  15. Hsu TW, Kuo CC, Tsai CC, Chiang YC (2009) Isolation and characterization of 16 microsatellite markers from a rare and endemic species, Scutellaria austrotaiwanensis (Lamiaceae). Conserv Genet Resour 1(1):85–88View ArticleGoogle Scholar
  16. Hubisz MJ, Falush D, Stephens M, Pritchard JK (2009) Inferring weak population structure with the assistance of sample group information. Mol Ecol Resour 9:1322–1332View ArticlePubMedPubMed CentralGoogle Scholar
  17. Kalendar R, Lee D, Schulman AH (2009) FastPCR software for PCR primer and probe design and repeat search. Genes Genomes Genom 3(1):1–14Google Scholar
  18. Lai JM, Tsai CC, Yen CR, Ko YZ, Chen SR, Weng IS, Lin YS, Chiang YC (2015) Molecular characterization of twenty polymorphic microsatellite markers in the polyploid fruit tree species Syzygium samarangense (Myrtaceae). Genet Mol Res 14(4):13013–13021View ArticlePubMedGoogle Scholar
  19. Liu K, Muse SV (2005) PowerMarker: an integrated analysis environment for genetic marker analysis. Bioinformatics 21(9):2128–2129View ArticlePubMedGoogle Scholar
  20. Liu YC, Lin BY, Lin JY, Wu WL, Chang CC (2016) Evaluation of chloroplast DNA markers for intraspecific identification of Phalaenopsis equestris cultivars. Sci Hortic 203:86–94View ArticleGoogle Scholar
  21. Men S, Ming X, Wang Y, Liu R, Wei C, Li Y (2003) Genetic transformation of two species of orchid by biolistic bombardment. Plant Cell Rep 21(6):592–598PubMedGoogle Scholar
  22. Powell W, Machray GC, Provan J (1996) Polymorphism revealed by simple sequence repeats. Trends Plant Sci 1(7):215–222View ArticleGoogle Scholar
  23. Pritchard JK, Stephens M, Donnelly P (2000) Inference of population structure using multilocus genotype data. Genetics 155:945–959PubMedPubMed CentralGoogle Scholar
  24. Rosenberg NA (2004) DISTRUCT: a program for the graphical display of population structure. Mol Ecol Notes 4:137–138View ArticleGoogle Scholar
  25. Sukma D (2011) Development of sequence-based microsatellite marker for Phalaenopsis orchid. Hayati J Biosci 18:71–76View ArticleGoogle Scholar
  26. Tanaka Y, Katsumoto Y, Brugliera F, Mason J (2005) Genetic engineering in floriculture. Plant Cell Tissue Organ Cult 80(1):1–24View ArticleGoogle Scholar
  27. Tang CY, Chen WH (2007) Breeding and development of new varieties in Phalaenopsis. In: Chen WH, Chen HH (eds) Orchids biotechnology. World Scientific Publishing Co. Pvt. Ltd, Singapore, p 1–22Google Scholar
  28. Tsai CC, Huang SC, Chou CH (2005) Molecular phylogeny of Phalaenopsis Blume (Orchidaceae) based on the internal transcribed spacer of the nuclear ribosomal DNA. Plant Syst Evol 256:1–16View ArticleGoogle Scholar
  29. Tsai CC, Chiang YC, Huang SC, Chen CH, Chou CH (2010) Molecular phylogeny of Phalaenopsis Blume (Orchidaceae) on the basis of plastid and nuclear DNA. Plant Syst Evol 288(1–2):77–98View ArticleGoogle Scholar
  30. Tsai CC, Chen YKH, Chen CH, Weng IS, Tsai CM, Lee SR, Lin YS, Chiang YC (2013) Cultivar identification and genetic relationship of mango (Mangifera indica) in Taiwan using 37 SSR markers. Sci Hortic 164:196–201View ArticleGoogle Scholar
  31. Tsai CC, Wu PY, Kuo CC, Huang MC, Yu SK, Hsu TW, Chiang TY, Chiang YC (2014) Analysis of microsatellites in the vulnerable orchid Gastrodia flavilabella: the development of microsatellite markers and cross-species amplification in Gastrodia. Bot Stud 55:72View ArticlePubMedPubMed CentralGoogle Scholar
  32. Tsai CC, Shih HC, Wang HV, Lin YS, Chang CH, Chiang YC, Chou CH (2015) RNA-seq SSRs of moth orchid and screening for molecular markers across genus Phalaenopsis (Orchidaceae). PLoS ONE 10(11):e0141761View ArticlePubMedPubMed CentralGoogle Scholar

Copyright

© The Author(s) 2017